The pTargeT™ Sequencing Primer is designed for sequencing inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector.
The primer can be used only for sequencing inserts cloned into the pTargeT™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts.
The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.
The primer is supplied at a concentra...
Expand to Read More »
The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.
« Collapse Content
pTargeT™ Sequencing Primer
pTargeT™ Sequencing Primer (24mer)
This product can be added to a
Helix Freezer
This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.
Already a Helix Customer?
Store at –20°C.
For product intended use please see Patents & Disclaimers tab.
Q4461 For Research Use Only. Not for Use in Diagnostic Procedures.
Your country is set to Spain. Your language is set to español. Please select the language that will best suit your needs:
This is correct, continue to site »
I need additional help